Detail of EST/Unigene BG455553 |
Acc. | BG455553 |
Internal Acc. | NF065C09PL1F1068 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor Tu, chloroplastic OS=Pisum sativum E-value=1e-17; Elongation factor Tu, chloroplastic OS=Nicotiana tabacum E-value=7e-17; Elongation factor TuB, chloroplastic OS=Nicotiana sylvestris E-value=7e-17; Elongation factor TuA, chloroplastic OS=Nicotiana sylvestris E-value=7e-17; Elongation factor Tu, chloroplastic OS=Glycine max E-value=5e-16; |
Length | 231 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GAAGAATTGAAAGGGGGCTTGTTAAGGTTGGTGATGTAGTTGACCTTGTTGGTTTGAGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.5.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827784 |
Trichome-related Gene from Literature | N/A |