| Detail of EST/Unigene BG455611 |
| Acc. | BG455611 |
| Internal Acc. | NF066A04PL1F1023 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable mannitol dehydrogenase OS=Medicago sativa E-value=8e-51; Probable cinnamyl alcohol dehydrogenase 9 OS=Arabidopsis thaliana E-value=2e-38; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=1e-36; Cinnamyl alcohol dehydrogenase 2 OS=Arabidopsis thaliana E-value=7e-36; Cinnamyl alcohol dehydrogenase 3 OS=Arabidopsis thaliana E-value=2e-35; |
| Length | 340 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | CAGAGATCGATGGCTGAAATCACCCGAAACAGAACTCCCACTCAAAGCTTTTGGTTGGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
| EC | 1.1.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830088 |
| Trichome-related Gene from Literature | N/A |