Detail of EST/Unigene BG456180 |
Acc. | BG456180 |
Internal Acc. | NF074H08PL1F1074 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=8e-18; Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum E-value=7e-17; Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=9e-14; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-12; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=3e-11; |
Length | 560 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GTTCAACTACTCTTGATGGGGTATGCTGAAACAAGAAGGTATATGGATTTTGTCAGTCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841099 |
Trichome-related Gene from Literature | N/A |