| Detail of EST/Unigene BG456211 |
| Acc. | BG456211 |
| Internal Acc. | NF075B07PL1F1059 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Plastidic ATP/ADP-transporter OS=Solanum tuberosum E-value=8e-85; ADP,ATP carrier protein 1, chloroplastic OS=Arabidopsis thaliana E-value=6e-83; ADP,ATP carrier protein 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-81; ADP,ATP carrier protein 1 OS=Chlamydia pneumoniae E-value=7e-39; ADP,ATP carrier protein 1 OS=Chlamydia muridarum (strain MoPn / Nigg) E-value=7e-38; |
| Length | 656 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | TTCTAAGTCAATATATATTTGACAAATATGGATGGGGAGTTGCTGCCAAGATCACACCTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS; 2.A.12 ATP:ADP antiporter AAA |
| Probeset |
|
| Corresponding NCBI Gene | 844370 |
| Trichome-related Gene from Literature | N/A |