| Detail of EST/Unigene BG456275 |
| Acc. | BG456275 |
| Internal Acc. | NF076A05PL1F1035 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=0; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=0; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=2e-96; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-95; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-95; |
| Length | 662 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | CAAAAGCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGGCTCTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818006 |
| Trichome-related Gene from Literature | N/A |