Detail of EST/Unigene BG456345 |
Acc. | BG456345 |
Internal Acc. | NF077C05PL1F1036 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-amidase NIT2 OS=Homo sapiens E-value=2e-26; Omega-amidase NIT2 OS=Rattus norvegicus E-value=2e-26; Omega-amidase NIT2 OS=Pongo abelii E-value=4e-26; Omega-amidase NIT2 OS=Mus musculus E-value=6e-26; Omega-amidase NIT2 OS=Danio rerio E-value=8e-26; |
Length | 649 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TTGAATTCATCAAACGAATGTAAGAAAGGGTTAATATCTATCCAAAACTTAAAAAAGTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01431 beta-ureidopropionase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01431 beta-ureidopropionase |
EC | 3.5.-.- 3.5.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831077 |
Trichome-related Gene from Literature | N/A |