Detail of EST/Unigene BG456385 |
Acc. | BG456385 |
Internal Acc. | NF078B11PL1F1091 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-99; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-98; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=2e-91; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=3e-91; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=4e-91; |
Length | 575 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | ATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGGCTCTCTCTTCACCAACCTTGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |