Detail of EST/Unigene BG456628 |
Acc. | BG456628 |
Internal Acc. | NF083B06PL1F1047 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Pisum sativum E-value=0; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Phaseolus vulgaris E-value=0; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Arabidopsis thaliana E-value=0; Carotenoid 9,10(9',10')-cleavage dioxygenase OS=Crocus sativus E-value=4e-98; Zeaxanthin 7,8(7',8')-cleavage dioxygenase, chromoplast OS=Crocus sativus E-value=6e-29; |
Length | 639 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CAATATCAGAGCCAATCATGATGCATGACTTTGCCATCACAGAGAACTATTCAATATTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00515 beta-carotene 15,15'-monooxygenase |
EC | 1.14.99.36 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825527 |
Trichome-related Gene from Literature | N/A |