Detail of EST/Unigene BG456658 |
Acc. | BG456658 |
Internal Acc. | NF096D10PL1F1080 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=0; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=0; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=0; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; |
Length | 682 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GCAAGGTTCACCATGAGGAAGGCTGCTACCACCAAGAAAGTAGCCTCCTCAGGAAGCCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |