Detail of EST/Unigene BG456744 |
Acc. | BG456744 |
Internal Acc. | NF096B08PL1F1063 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=3e-29; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=3e-29; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=2e-27; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=5e-26; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=5e-22; |
Length | 664 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CTACAACGCTACCCTTATCCACAAACAACGATATTGTTGTGTTGTTCCTTTCCTCTTCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835090 |
Trichome-related Gene from Literature | N/A |