Detail of EST/Unigene BG456980 |
Acc. | BG456980 |
Internal Acc. | NF098G09PL1F1070 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-quinone oxidoreductase chain 4, chloroplastic OS=Lotus japonicus E-value=4e-55; NAD(P)H-quinone oxidoreductase chain 4, chloroplastic OS=Carica papaya E-value=5e-53; NAD(P)H-quinone oxidoreductase chain 4, chloroplastic OS=Glycine max E-value=5e-52; NAD(P)H-quinone oxidoreductase chain 4, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=5e-52; NAD(P)H-quinone oxidoreductase chain 4, chloroplastic OS=Nicotiana tabacum E-value=5e-51; |
Length | 383 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AATATTTTGTATTTTTTTTTGAGCACGGGCTTTTCTGGCCCAAGTGTATCTTATTTTTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |