Detail of EST/Unigene BG457062 |
Acc. | BG457062 |
Internal Acc. | NF069C06PL1F1040 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S19, chloroplastic OS=Glycine max E-value=6e-35; 30S ribosomal protein S19, chloroplastic OS=Phaseolus vulgaris E-value=6e-35; 30S ribosomal protein S19, chloroplastic OS=Phaseolus angularis E-value=6e-35; 30S ribosomal protein S19, chloroplastic OS=Pisum sativum E-value=1e-34; 30S ribosomal protein S19, chloroplastic OS=Manihot esculenta E-value=2e-34; |
Length | 657 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GAAAAGAGTGATTTACTATGACATTATATGATTTGATTTTGTTTTTTTAGAGATTATATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |