Detail of EST/Unigene BG457250 |
Acc. | BG457250 |
Internal Acc. | NF102B12PL1F1095 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-89; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-89; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=2e-88; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=2e-88; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=5e-88; |
Length | 579 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CTTCAAGCCAAGAATTGGGAGCTGCAAGGTTCACCATGAGGAAGGCTGCTACCACCAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |