| Detail of EST/Unigene BG457661 |
| Acc. | BG457661 |
| Internal Acc. | NF033E09PL1F1068 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=1e-75; 30S ribosomal protein S3, chloroplastic OS=Glycine max E-value=3e-73; 30S ribosomal protein S3, chloroplastic OS=Phaseolus angularis E-value=1e-71; 30S ribosomal protein S3, chloroplastic OS=Phaseolus vulgaris E-value=7e-71; 30S ribosomal protein S3, chloroplastic OS=Olimarabidopsis pumila E-value=9e-71; |
| Length | 653 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | ATATAGTTCAACGAACTAAGTCAATGAGTCATAAAGATATATAATATTTTTTATATAAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.2.2.23 4.2.99.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |