Detail of EST/Unigene BG457661 |
Acc. | BG457661 |
Internal Acc. | NF033E09PL1F1068 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=1e-75; 30S ribosomal protein S3, chloroplastic OS=Glycine max E-value=3e-73; 30S ribosomal protein S3, chloroplastic OS=Phaseolus angularis E-value=1e-71; 30S ribosomal protein S3, chloroplastic OS=Phaseolus vulgaris E-value=7e-71; 30S ribosomal protein S3, chloroplastic OS=Olimarabidopsis pumila E-value=9e-71; |
Length | 653 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | ATATAGTTCAACGAACTAAGTCAATGAGTCATAAAGATATATAATATTTTTTATATAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.2.2.23 4.2.99.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |