Detail of EST/Unigene BG457716 |
Acc. | BG457716 |
Internal Acc. | NF034E05PL1F1036 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L33, chloroplastic OS=Cicer arietinum E-value=7e-32; 50S ribosomal protein L33, chloroplastic OS=Glycine max E-value=2e-27; 50S ribosomal protein L33, chloroplastic OS=Nicotiana tabacum E-value=1e-26; 50S ribosomal protein L33, chloroplastic OS=Nicotiana tomentosiformis E-value=1e-26; 50S ribosomal protein L33, chloroplastic OS=Nicotiana sylvestris E-value=1e-26; |
Length | 608 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TGAGACCCTAAATGGAATTGTAATAGAATACTTGGGCGGGTCAATAATATCATACAAGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |