| Detail of EST/Unigene BG457755 |
| Acc. | BG457755 |
| Internal Acc. | NF033A02PL1F1005 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Histidine decarboxylase OS=Solanum lycopersicum E-value=7e-71; Histidine decarboxylase OS=Pseudomonas entomophila (strain L48) E-value=4e-42; Histidine decarboxylase OS=Pseudomonas fluorescens E-value=4e-41; Histidine decarboxylase OS=Morganella morganii E-value=2e-40; Histidine decarboxylase OS=Vibrio anguillarum (strain ATCC 68554 / 775) E-value=1e-38; |
| Length | 648 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | GTCACATTATTCAATTTTTAAAGCTGCCCGTATGTACAGAATGGAATGTGAAAAGGTTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01580 glutamate decarboxylase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01580 glutamate decarboxylase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01580 glutamate decarboxylase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01580 glutamate decarboxylase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K01580 glutamate decarboxylase |
| EC | 4.1.1.15 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840958 |
| Trichome-related Gene from Literature | N/A |