Detail of EST/Unigene BG457795 |
Acc. | BG457795 |
Internal Acc. | NF037E02PL1F1008 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit XI, chloroplastic OS=Spinacia oleracea E-value=6e-50; Photosystem I reaction center subunit XI, chloroplastic OS=Cucumis sativus E-value=8e-50; Photosystem I reaction center subunit XI, chloroplastic OS=Arabidopsis thaliana E-value=1e-49; Photosystem I reaction center subunit XI, chloroplastic OS=Hordeum vulgare E-value=2e-40; Photosystem I reaction center subunit XI OS=Guillardia theta E-value=6e-22; |
Length | 459 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TCATGGCAGCTGCTTCTCCTATGGCAAGCCAACTCAAGTCCAGCTTCACTAGACCTTTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826892 |
Trichome-related Gene from Literature | N/A |