| Detail of EST/Unigene BG458028 |
| Acc. | BG458028 |
| Internal Acc. | NF037E07PL1F1052 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase delta chain, chloroplastic OS=Pisum sativum E-value=9e-33; ATP synthase delta chain, chloroplastic OS=Nicotiana tabacum E-value=6e-16; ATP synthase delta chain, chloroplastic OS=Spinacia oleracea E-value=4e-10; ATP synthase delta chain, chloroplastic OS=Sorghum bicolor E-value=8e-08; |
| Length | 568 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | TTCCTCTCCACTCAATGCTATCAGTATCACACCTTCTTCTTCCCACCAATCACAGCAAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826551 |
| Trichome-related Gene from Literature | N/A |