Detail of EST/Unigene BG458121 |
Acc. | BG458121 |
Internal Acc. | NF050D07PL1F1059 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase leaf isozyme, chloroplastic OS=Medicago sativa E-value=3e-30; Glutamine synthetase leaf isozyme, chloroplastic OS=Phaseolus vulgaris E-value=1e-29; Glutamine synthetase leaf isozyme, chloroplastic OS=Pisum sativum E-value=1e-29; Glutamine synthetase, chloroplastic OS=Daucus carota E-value=5e-26; Glutamine synthetase, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-26; |
Length | 438 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AACACATTTTCTTGGGGAGTGGCTAACCGTGGATGCTCAATCCGTGTGGGAAGAGACACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833535 |
Trichome-related Gene from Literature | N/A |