| Detail of EST/Unigene BG458146 |
| Acc. | BG458146 |
| Internal Acc. | NF051A05PL1F1034 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S14, chloroplastic OS=Cicer arietinum E-value=4e-28; 30S ribosomal protein S14, chloroplastic OS=Lotus japonicus E-value=2e-27; 30S ribosomal protein S14, chloroplastic OS=Lobularia maritima E-value=3e-27; 30S ribosomal protein S14, chloroplastic OS=Glycine max E-value=2e-26; 30S ribosomal protein S14, chloroplastic OS=Solanum tuberosum E-value=2e-26; |
| Length | 195 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | CGTTAAGTGAGAAATGGGAAATTCAGGGAAAGTTAGAAGCACTACCGCGTAATAGTGCAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |