Detail of EST/Unigene BG627118 |
Acc. | BG627118 |
Internal Acc. | cC-esflcLEL16D22d1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-51; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-50; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-50; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=5e-50; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=3e-49; |
Length | 409 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_FLOWER_DEV; |
Sequence | ATCCAAACAAATATGCATTCTATGAAGTCACAACTACTTTACAGGGCCATCAAACAATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |