Detail of EST/Unigene BG627526 |
Acc. | BG627526 |
Internal Acc. | cC-esflcLEL17P08d1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=1e-45; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=5e-45; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=2e-44; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=2e-44; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=9e-44; |
Length | 415 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_FLOWER_DEV; |
Sequence | AGCAAAAAACTTCATATATAATCAATCTCTAGTAATCTACAATTGCTAGGTTTACATGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822391 |
Trichome-related Gene from Literature | N/A |