| Detail of EST/Unigene BG627526 |
| Acc. | BG627526 |
| Internal Acc. | cC-esflcLEL17P08d1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=1e-45; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=5e-45; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=2e-44; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=2e-44; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=9e-44; |
| Length | 415 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_FLOWER_DEV; |
| Sequence | AGCAAAAAACTTCATATATAATCAATCTCTAGTAATCTACAATTGCTAGGTTTACATGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822391 |
| Trichome-related Gene from Literature | N/A |