Detail of EST/Unigene BG644543 |
Acc. | BG644543 |
Internal Acc. | EST506162 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=0; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-93; Chaperonin 60 subunit beta 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-91; Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-90; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Brassica napus E-value=9e-90; |
Length | 776 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | TCCTCTTAAAACCCTAGCCACCATTTTCTCCCAATTCCACACTACCATGGCGTCATTAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820549 |
Trichome-related Gene from Literature | N/A |