Detail of EST/Unigene BG644553 |
Acc. | BG644553 |
Internal Acc. | EST506172 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=1e-46; Cytochrome P450 71B34 OS=Arabidopsis thaliana E-value=1e-45; 2-methylbutanal oxime monooxygenase OS=Manihot esculenta E-value=1e-44; Cytochrome P450 71B10 OS=Arabidopsis thaliana E-value=3e-44; Cytochrome P450 71B12 OS=Arabidopsis thaliana E-value=3e-44; |
Length | 799 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | CTTCCTTTCATTGGAAACTTACACCAACTTGATAGTTCAGTTCTTGGTTTAAATTTCTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829277 |
Trichome-related Gene from Literature | N/A |