| Detail of EST/Unigene BG644822 |
| Acc. | BG644822 |
| Internal Acc. | EST506441 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=5e-31; 30 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=5e-31; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=5e-29; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=6e-29; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=8e-29; |
| Length | 734 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | TCACCAAAATCCATGCATAATATTTTGCAACATAATGAGTAATCCATAACATAATACTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818299 |
| Trichome-related Gene from Literature | N/A |