Detail of EST/Unigene BG644878 |
Acc. | BG644878 |
Internal Acc. | EST506497 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protease Do-like 9 OS=Arabidopsis thaliana E-value=3e-76; Protease Do-like 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-51; Putative protease Do-like 3, mitochondrial OS=Arabidopsis thaliana E-value=3e-44; Protease Do-like 10, mitochondrial OS=Arabidopsis thaliana E-value=6e-43; Protease Do-like 4, mitochondrial OS=Arabidopsis thaliana E-value=3e-39; |
Length | 783 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | ACCGCCACCACCACCACCACCACCACTGCTACCACCACCGTCGCAGACAACCCTTCCACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834018 |
Trichome-related Gene from Literature | N/A |