| Detail of EST/Unigene BG644946 |
| Acc. | BG644946 |
| Internal Acc. | EST506565 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase CVP2 OS=Arabidopsis thaliana E-value=4e-17; Type I inositol 1,4,5-trisphosphate 5-phosphatase 2 OS=Arabidopsis thaliana E-value=3e-15; Type I inositol 1,4,5-trisphosphate 5-phosphatase 1 OS=Arabidopsis thaliana E-value=6e-14; |
| Length | 765 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | TCAACTTCCTCTACCTCTCAACATGATATACTCTTCAATACTTTATATTAATCATTATTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 814721 |
| Trichome-related Gene from Literature | N/A |