Detail of EST/Unigene BG644984 |
Acc. | BG644984 |
Internal Acc. | EST506603 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=8e-30; 30 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=8e-30; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=8e-28; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=1e-27; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=1e-27; |
Length | 700 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | CACCAAAATCCATGCATAATATTTTCCAACATAATGAGTAATCCATAACATAATACTGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818299 |
Trichome-related Gene from Literature | N/A |