| Detail of EST/Unigene BG645015 |
| Acc. | BG645015 |
| Internal Acc. | EST506634 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase small chain OS=Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1) E-value=6e-50; Carbamoyl-phosphate synthase small chain OS=Synechococcus elongatus (strain PCC 7942) E-value=6e-50; Carbamoyl-phosphate synthase small chain OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=5e-49; Carbamoyl-phosphate synthase small chain OS=Halomonas eurihalina E-value=5e-49; Carbamoyl-phosphate synthase small chain OS=Pseudomonas stutzeri E-value=1e-48; |
| Length | 790 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | TTGGGCCTTCACCCTATCTCTCATGACTGCTTTGGTTCCAATCGCCACACACTGCTTCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase |
| EC | 2.1.3.2 3.5.2.3 6.3.5.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822396 |
| Trichome-related Gene from Literature | N/A |