Detail of EST/Unigene BG645184 |
Acc. | BG645184 |
Internal Acc. | EST506803 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Translation factor GUF1 homolog, mitochondrial OS=Ricinus communis E-value=0; Translation factor GUF1 homolog, mitochondrial OS=Oryza sativa subsp. japonica E-value=0; Translation factor GUF1 homolog, mitochondrial OS=Oryza sativa subsp. indica E-value=0; Translation factor GUF1 homolog, mitochondrial OS=Sorghum bicolor E-value=0; Translation factor GUF1 homolog, mitochondrial OS=Arabidopsis thaliana E-value=0; |
Length | 740 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | AAACTACTCTTGCTGATCGGTTATTGGAGCTTACTGGTACTATTAAGAAAGGACTTGGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.5.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833987 |
Trichome-related Gene from Literature | N/A |