Detail of EST/Unigene BG645188 |
Acc. | BG645188 |
Internal Acc. | EST506807 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mannan endo-1,4-beta-mannosidase 2 OS=Arabidopsis thaliana E-value=1e-30; Mannan endo-1,4-beta-mannosidase 5 OS=Arabidopsis thaliana E-value=1e-26; Mannan endo-1,4-beta-mannosidase 2 OS=Oryza sativa subsp. japonica E-value=1e-23; Putative mannan endo-1,4-beta-mannosidase 5 OS=Oryza sativa subsp. japonica E-value=2e-15; Mannan endo-1,4-beta-mannosidase 6 OS=Arabidopsis thaliana E-value=1e-14; |
Length | 699 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | GATTTTCTGATACTAACATTTCACCACACTCGCTTTTTTCCTCTTCAACCTTATAAGTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816596 |
Trichome-related Gene from Literature | N/A |