| Detail of EST/Unigene BG645303 |
| Acc. | BG645303 |
| Internal Acc. | EST506922 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Plastid lipid-associated protein 1, chloroplastic OS=Brassica campestris E-value=4e-15; Plastid-lipid-associated protein, chloroplastic OS=Citrus unshiu E-value=4e-14; Chromoplast-specific carotenoid-associated protein, chromoplast OS=Cucumis sativus E-value=3e-12; Plastid lipid-associated protein 2, chloroplastic OS=Brassica campestris E-value=1e-11; Probable plastid-lipid-associated protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-11; |
| Length | 366 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | AACCTAAACCACTTCTCCTACAAACACTCTTCCAGTAACCTCTCTCAACTCCACACCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825714 |
| Trichome-related Gene from Literature | N/A |