Detail of EST/Unigene BG645303 |
Acc. | BG645303 |
Internal Acc. | EST506922 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastid lipid-associated protein 1, chloroplastic OS=Brassica campestris E-value=4e-15; Plastid-lipid-associated protein, chloroplastic OS=Citrus unshiu E-value=4e-14; Chromoplast-specific carotenoid-associated protein, chromoplast OS=Cucumis sativus E-value=3e-12; Plastid lipid-associated protein 2, chloroplastic OS=Brassica campestris E-value=1e-11; Probable plastid-lipid-associated protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-11; |
Length | 366 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | AACCTAAACCACTTCTCCTACAAACACTCTTCCAGTAACCTCTCTCAACTCCACACCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825714 |
Trichome-related Gene from Literature | N/A |