Detail of EST/Unigene BG645325 |
Acc. | BG645325 |
Internal Acc. | EST506944 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glycinol 4-dimethylallyltransferase OS=Glycine max E-value=9e-60; Homogentisate phytyltransferase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-54; Probable homogentisate phytyltransferase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-49; Naringenin 8-dimethylallyltransferase 1, chloroplastic OS=Sophora flavescens E-value=2e-44; Homogentisate phytyltransferase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-12; |
Length | 811 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | TTTGGTAAATTCGCAGGTGGAAAATAACCAAAGCATCTTCATTGCATGCCATTGCTTTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816412 |
Trichome-related Gene from Literature | N/A |