| Detail of EST/Unigene BG645325 |
| Acc. | BG645325 |
| Internal Acc. | EST506944 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycinol 4-dimethylallyltransferase OS=Glycine max E-value=9e-60; Homogentisate phytyltransferase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-54; Probable homogentisate phytyltransferase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-49; Naringenin 8-dimethylallyltransferase 1, chloroplastic OS=Sophora flavescens E-value=2e-44; Homogentisate phytyltransferase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-12; |
| Length | 811 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | TTTGGTAAATTCGCAGGTGGAAAATAACCAAAGCATCTTCATTGCATGCCATTGCTTTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816412 |
| Trichome-related Gene from Literature | N/A |