Detail of EST/Unigene BG645336 |
Acc. | BG645336 |
Internal Acc. | EST506955 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glycine dehydrogenase [decarboxylating], mitochondrial OS=Pisum sativum E-value=0; Glycine dehydrogenase [decarboxylating], mitochondrial OS=Solanum tuberosum E-value=0; Glycine dehydrogenase [decarboxylating] 1, mitochondrial OS=Arabidopsis thaliana E-value=0; Glycine dehydrogenase [decarboxylating] 2, mitochondrial OS=Arabidopsis thaliana E-value=0; Glycine dehydrogenase [decarboxylating], mitochondrial OS=Flaveria trinervia E-value=0; |
Length | 768 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | AACTTTGGAAAAGCTTATCAACATCCTCTATGTAGTTGTTTCATCAAACGCAGCAGTGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.4.4.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817149 |
Trichome-related Gene from Literature | N/A |