Detail of EST/Unigene BG645371 |
Acc. | BG645371 |
Internal Acc. | EST506990 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-99; Argininosuccinate synthase OS=Roseiflexus sp. (strain RS-1) E-value=8e-70; Argininosuccinate synthase OS=Vibrio harveyi (strain ATCC BAA-1116 / BB120) E-value=9e-70; Argininosuccinate synthase OS=Carboxydothermus hydrogenoformans (strain Z-2901 / DSM 6008) E-value=1e-69; Argininosuccinate synthase OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) E-value=3e-69; |
Length | 834 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | CAATTCTTACATTACTCATCCCCAGCTATTGGCTCCTACCAAACATGCAAAAGACACCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01940 argininosuccinate synthase |
EC | 6.3.4.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828586 |
Trichome-related Gene from Literature | N/A |