| Detail of EST/Unigene BG645391 |
| Acc. | BG645391 |
| Internal Acc. | EST507010 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Glycine max E-value=3e-32; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=2e-20; Alternative oxidase 3, mitochondrial OS=Glycine max E-value=5e-20; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=8e-17; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=2e-14; |
| Length | 832 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | TGTCACGTGTCGCACATTGATGTGGATGTAAAAAAATGTGTACAAATGAAGTGTGTCGAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836542 |
| Trichome-related Gene from Literature | 836542 |