| Detail of EST/Unigene BG645686 |
| Acc. | BG645686 |
| Internal Acc. | EST507305 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | UDP-glucose 6-dehydrogenase OS=Glycine max E-value=0; Probable UDP-glucose 6-dehydrogenase 1 OS=Arabidopsis thaliana E-value=2e-95; Probable UDP-glucose 6-dehydrogenase 2 OS=Arabidopsis thaliana E-value=4e-66; UDP-glucose 6-dehydrogenase OS=Drosophila melanogaster E-value=4e-42; UDP-glucose 6-dehydrogenase OS=Gallus gallus E-value=2e-38; |
| Length | 827 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | AATGGAAACAAAAGTACATTCATAACAGCCATATAGAAATGGATGGGAGTACAAAAACAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00053 Ascorbate and aldarate metabolism > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00012 UDPglucose 6-dehydrogenase |
| EC | 1.1.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822594 |
| Trichome-related Gene from Literature | N/A |