Detail of EST/Unigene BG645850 |
Acc. | BG645850 |
Internal Acc. | EST507469 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cullin-1 OS=Arabidopsis thaliana E-value=3e-60; Putative cullin-like protein 2 OS=Arabidopsis thaliana E-value=2e-44; Putative cullin-like protein 1 OS=Arabidopsis thaliana E-value=7e-37; Cullin-2 OS=Arabidopsis thaliana E-value=1e-36; Cullin-like protein 3 OS=Arabidopsis thaliana E-value=2e-36; |
Length | 538 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | CCTATACACAACTATATATAATATGTGTACTCAGAAAGCCTCCAAATGACTAATTCCCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03347 cullin 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03347 cullin 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03347 cullin 1; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K10609 cullin 4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10609 cullin 4 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825648 |
Trichome-related Gene from Literature | N/A |