Detail of EST/Unigene BG645853 |
Acc. | BG645853 |
Internal Acc. | EST507472 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 1-aminocyclopropane-1-carboxylate synthase 7 OS=Arabidopsis thaliana E-value=2e-95; 1-aminocyclopropane-1-carboxylate synthase CMA101 OS=Cucurbita maxima E-value=8e-76; 1-aminocyclopropane-1-carboxylate synthase 6 OS=Arabidopsis thaliana E-value=1e-75; 1-aminocyclopropane-1-carboxylate synthase 2 OS=Solanum lycopersicum E-value=1e-75; 1-aminocyclopropane-1-carboxylate synthase OS=Malus domestica E-value=1e-74; |
Length | 721 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | TTCCCCTCCTTCTAAAATAGTTAGTATGGGTCTTGAGATTGAACAAGAAACCACCCTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
EC | 2.6.1.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828726 |
Trichome-related Gene from Literature | 828726 |