Detail of EST/Unigene BG645945 |
Acc. | BG645945 |
Internal Acc. | EST507564 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Exostosin-2 OS=Drosophila melanogaster E-value=2e-27; Exostosin-3 OS=Drosophila melanogaster E-value=5e-24; Exostosin-2 OS=Mus musculus E-value=2e-22; Exostosin-2 OS=Homo sapiens E-value=3e-22; Exostosin-2 OS=Bos taurus E-value=3e-22; |
Length | 761 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | TCAATATTCGCAGTTCACGTTATTGACAATGACCTACGATGCTCGTCTGTGGAACTTGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02369 alpha-1,4-N-acetylglucosaminyltransferase EXTL2; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02369 alpha-1,4-N-acetylglucosaminyltransferase EXTL2 |
EC | 2.4.1.- 2.4.1.17 2.4.1.224 2.4.1.225 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830329 |
Trichome-related Gene from Literature | N/A |