Detail of EST/Unigene BG645960 |
Acc. | BG645960 |
Internal Acc. | EST507579 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 13, mitochondrial OS=Arabidopsis thaliana E-value=6e-34; Nudix hydrolase 12, mitochondrial OS=Arabidopsis thaliana E-value=7e-34; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=8e-26; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=1e-18; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=5e-18; |
Length | 680 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | TCTGCATAATCTTTTGGACATTTGTTCTTCTTCTGCCTTTGGACCCCATGCTGTGGAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.1.52 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822281 |
Trichome-related Gene from Literature | N/A |