Detail of EST/Unigene BG645983 |
Acc. | BG645983 |
Internal Acc. | EST507602 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Isocitrate dehydrogenase [NADP], chloroplastic (Fragment) OS=Medicago sativa E-value=2e-90; Isocitrate dehydrogenase [NADP] OS=Solanum tuberosum E-value=2e-88; Isocitrate dehydrogenase [NADP] OS=Nicotiana tabacum E-value=4e-88; Isocitrate dehydrogenase [NADP] OS=Glycine max E-value=2e-85; Isocitrate dehydrogenase [NADP], mitochondrial OS=Mus musculus E-value=3e-70; |
Length | 656 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | GGTTGAAACAAACGAACCAACAAAGTACGAGGTTGGGTCTGATCCCAACACAACTAAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00031 isocitrate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00031 isocitrate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00031 isocitrate dehydrogenase |
EC | 1.1.1.42 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841875 |
Trichome-related Gene from Literature | N/A |