Detail of EST/Unigene BG646149 |
Acc. | BG646149 |
Internal Acc. | EST507768 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase large chain OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=3e-69; Carbamoyl-phosphate synthase large chain OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=4e-69; Carbamoyl-phosphate synthase large chain OS=Xanthomonas axonopodis pv. citri (strain 306) E-value=4e-59; Carbamoyl-phosphate synthase large chain OS=Xanthomonas campestris pv. campestris (strain ATCC 33913 / NCPPB 528 / LMG 568) E-value=6e-59; Carbamoyl-phosphate synthase large chain OS=Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126) E-value=1e-58; |
Length | 592 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | AAATCCCGAGACTGTATCCACAGATTACGACACTAGTGATCGTCTCTACTTTGAACCCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase |
EC | 2.1.3.2 3.5.2.3 6.3.4.16 6.3.5.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839868 |
Trichome-related Gene from Literature | N/A |