Detail of EST/Unigene BG734640 |
Acc. | BG734640 |
Internal Acc. | cC-esflcLEL12I09d1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=9e-34; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=1e-33; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-33; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-33; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=3e-33; |
Length | 365 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_FLOWER_DEV; |
Sequence | CATCCAATAACAATACTCATATATATTATTATGTTCTTGTAATTTACAATTAGCAAACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |