| Detail of EST/Unigene BI205649 |
| Acc. | BI205649 |
| Internal Acc. | EST523689 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform PR-Q' OS=Nicotiana tabacum E-value=5e-40; Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=4e-25; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Prunus persica E-value=6e-25; Glucan endo-1,3-beta-glucosidase OS=Glycine max E-value=2e-24; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=3e-24; |
| Length | 291 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_cTOS; |
| Sequence | TTGGGTCCAAAACAATGTTAGGAACTATGGTAATGTTAAGTTCAGGTATATAGCTGTTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |