| Detail of EST/Unigene BI207380 |
| Acc. | BI207380 |
| Internal Acc. | EST525420 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=7e-44; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Rattus norvegicus E-value=4e-15; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Mus musculus E-value=7e-15; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Sus scrofa E-value=1e-14; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Bos taurus E-value=2e-14; |
| Length | 525 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_cTOS; |
| Sequence | CTTCACAATAAGCATAACACATTGGCTGGTCAGCGGGTAATCATGTTTTCTTATGGGAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01641 hydroxymethylglutaryl-CoA synthase |
| EC | 2.3.3.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826788 |
| Trichome-related Gene from Literature | 826788 |