Detail of EST/Unigene BI208199 |
Acc. | BI208199 |
Internal Acc. | EST526239 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase A OS=Solanum lycopersicum E-value=4e-92; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-N (Fragment) OS=Nicotiana tabacum E-value=3e-67; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=3e-67; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-67; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=2e-66; |
Length | 562 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_cTOS; |
Sequence | CGCGATGAATATAAAAGTTTCATCAATCCCATAATTGGATTTCTATCAAGACATAATCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |