Detail of EST/Unigene BI262783 |
Acc. | BI262783 |
Internal Acc. | NF091F08EC1F1075 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hexokinase-2, chloroplastic OS=Nicotiana tabacum E-value=5e-43; Hexokinase-4, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-37; Hexokinase-like 1 protein OS=Arabidopsis thaliana E-value=2e-34; Hexokinase-9 OS=Oryza sativa subsp. japonica E-value=2e-34; Hexokinase-1 OS=Arabidopsis thaliana E-value=6e-33; |
Length | 529 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | GAAAACATGTCTGTTTCTGTTTCTGTTACTGTTACTGTTACCTCTACCGTGGGACCCTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
EC | 2.7.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841200 |
Trichome-related Gene from Literature | N/A |