Detail of EST/Unigene BI263054 |
Acc. | BI263054 |
Internal Acc. | NF035C03PL1F1022 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=3e-50; Protochlorophyllide reductase, chloroplastic OS=Cucumis sativus E-value=1e-45; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=7e-41; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=8e-40; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=9e-36; |
Length | 449 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CAATCTTACTTTGCTAAGTTTCAATGGCTCTTCAAGCTACTTCTTGCCTTCCTGCTTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.1.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835507 |
Trichome-related Gene from Literature | N/A |