| Detail of EST/Unigene BI263370 |
| Acc. | BI263370 |
| Internal Acc. | NF090B06PL1F1057 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=8e-32; Geraniol 8-hydroxylase OS=Swertia mussotii E-value=2e-31; 7-ethoxycoumarin O-deethylase OS=Helianthus tuberosus E-value=4e-27; Cytochrome P450 76C3 OS=Arabidopsis thaliana E-value=2e-22; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=1e-21; |
| Length | 673 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | TAGCATCTATATATCCTGGTTGATTTCTTGTGCTTGAGAAAGATATGGATTATGGTAGTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
| EC | 1.14.14.1 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825276 |
| Trichome-related Gene from Literature | N/A |